ID: 1003128507_1003128519

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1003128507 1003128519
Species Human (GRCh38) Human (GRCh38)
Location 6:3375496-3375518 6:3375542-3375564
Sequence CCAGAATCAATGTGGGCCAGTGG GGGCAGGGATATGAGTTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 78} {0: 1, 1: 0, 2: 1, 3: 25, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!