ID: 1003131031_1003131033

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1003131031 1003131033
Species Human (GRCh38) Human (GRCh38)
Location 6:3395408-3395430 6:3395432-3395454
Sequence CCATCCATCTTGTAAAGATCAGC TCATTAGCAAGAAGAGTAATAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!