ID: 1003138916_1003138930

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1003138916 1003138930
Species Human (GRCh38) Human (GRCh38)
Location 6:3455943-3455965 6:3455986-3456008
Sequence CCGTAGTCCCATGCGCGGCAGTC CCTTGTCCGGAGGGGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31} {0: 1, 1: 0, 2: 1, 3: 11, 4: 114}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!