ID: 1003175760_1003175779

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1003175760 1003175779
Species Human (GRCh38) Human (GRCh38)
Location 6:3751546-3751568 6:3751583-3751605
Sequence CCCGCCAAGGGCTCCCCAGCCCC CGCAGGAGGCGCGCCCCGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 70, 4: 693} {0: 1, 1: 0, 2: 1, 3: 23, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!