ID: 1003198818_1003198822

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1003198818 1003198822
Species Human (GRCh38) Human (GRCh38)
Location 6:3939868-3939890 6:3939908-3939930
Sequence CCAGGCTCCATCTGTGGAGCTGA GGACATTAATGATTTGCTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 15, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!