|
Left Crispr |
Right Crispr |
| Crispr ID |
1003207267 |
1003207271 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:4024218-4024240
|
6:4024241-4024263
|
| Sequence |
CCAGGCTGTTCTTGAACTACTGG |
GCTCAAGTGCTGCAGGTACTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 665, 2: 23486, 3: 100520, 4: 169249} |
{0: 1, 1: 0, 2: 1, 3: 4, 4: 111} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|