ID: 1003245409_1003245413

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1003245409 1003245413
Species Human (GRCh38) Human (GRCh38)
Location 6:4378344-4378366 6:4378359-4378381
Sequence CCTGGGGGAGGTGCTCCTTCCAC CCTTCCACACAGGGCCCTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 456} {0: 1, 1: 0, 2: 3, 3: 23, 4: 270}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!