ID: 1003289939_1003289944

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1003289939 1003289944
Species Human (GRCh38) Human (GRCh38)
Location 6:4771697-4771719 6:4771743-4771765
Sequence CCTAGTTGTTCTCTCTCTCTCTT AGGTAAAGACGATACTGGGATGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 29, 3: 312, 4: 2058} {0: 1, 1: 0, 2: 0, 3: 6, 4: 105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!