ID: 1003292265_1003292273

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1003292265 1003292273
Species Human (GRCh38) Human (GRCh38)
Location 6:4789483-4789505 6:4789504-4789526
Sequence CCTGGCAGCCTCCCCGCCCTAGG GGCATCTCCCCCACTCCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 357} {0: 1, 1: 0, 2: 1, 3: 26, 4: 232}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!