ID: 1003305609_1003305611

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1003305609 1003305611
Species Human (GRCh38) Human (GRCh38)
Location 6:4924579-4924601 6:4924617-4924639
Sequence CCATTGAGCTCTTGCTGGTTGGT AAGCATATCATTAAGTTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 124} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!