ID: 1003306040_1003306052

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1003306040 1003306052
Species Human (GRCh38) Human (GRCh38)
Location 6:4930436-4930458 6:4930474-4930496
Sequence CCCATCCCTGCACCTGCACTGTG GGAAAGGCGGGTGGACTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 5, 3: 55, 4: 447} {0: 1, 1: 0, 2: 0, 3: 14, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!