ID: 1003311650_1003311657

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1003311650 1003311657
Species Human (GRCh38) Human (GRCh38)
Location 6:4974248-4974270 6:4974269-4974291
Sequence CCCAAACTCAGAGCCGGTTCTGG GGCTCTTGGCTCCGGTGGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!