ID: 1003330054_1003330058

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1003330054 1003330058
Species Human (GRCh38) Human (GRCh38)
Location 6:5122231-5122253 6:5122280-5122302
Sequence CCTGCTTGGTTGGACGGTACAGA CTAGAAGTTCCTGACTTTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 14, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!