ID: 1003331244_1003331253

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1003331244 1003331253
Species Human (GRCh38) Human (GRCh38)
Location 6:5130344-5130366 6:5130390-5130412
Sequence CCAAGCAGGGGCTAGAGAGCAAG CTGGCATTGCACAGGGGACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 25, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!