ID: 1003340707_1003340714

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1003340707 1003340714
Species Human (GRCh38) Human (GRCh38)
Location 6:5217819-5217841 6:5217868-5217890
Sequence CCTATCTCTAGCTCTACCCCAAC AAGGAGAAGCAGACTGAGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 239} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!