ID: 1003369649_1003369651

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1003369649 1003369651
Species Human (GRCh38) Human (GRCh38)
Location 6:5511840-5511862 6:5511857-5511879
Sequence CCTAAATAGAACAGGGACAGGTT CAGGTTCAGGAGTCTGTTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 16, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!