ID: 1003380476_1003380480

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1003380476 1003380480
Species Human (GRCh38) Human (GRCh38)
Location 6:5620438-5620460 6:5620460-5620482
Sequence CCAAGGAACAGAGAGACCCACTT TGTTCAAATGTAGGACAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 230} {0: 1, 1: 0, 2: 0, 3: 11, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!