ID: 1003389673_1003389680

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1003389673 1003389680
Species Human (GRCh38) Human (GRCh38)
Location 6:5702893-5702915 6:5702925-5702947
Sequence CCCTGGGATGTCACTGTGTTCAC CACCAAGAAATTTCATATGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 205} {0: 1, 1: 1, 2: 3, 3: 17, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!