ID: 1003389673_1003389683

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1003389673 1003389683
Species Human (GRCh38) Human (GRCh38)
Location 6:5702893-5702915 6:5702933-5702955
Sequence CCCTGGGATGTCACTGTGTTCAC AATTTCATATGAAGGGACTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 205} {0: 2, 1: 0, 2: 0, 3: 12, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!