ID: 1003390222_1003390227

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1003390222 1003390227
Species Human (GRCh38) Human (GRCh38)
Location 6:5707279-5707301 6:5707323-5707345
Sequence CCATTATTCCAATATTACATGGA CTGAGAATAAAGTGGTACCAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 21, 4: 254} {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!