ID: 1003391775_1003391779

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1003391775 1003391779
Species Human (GRCh38) Human (GRCh38)
Location 6:5719544-5719566 6:5719582-5719604
Sequence CCTTTCTTCAGAAATCTCAGGTA CACAACTCAATGCCCTCGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 244} {0: 2, 1: 0, 2: 1, 3: 7, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!