ID: 1003403456_1003403461

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1003403456 1003403461
Species Human (GRCh38) Human (GRCh38)
Location 6:5809624-5809646 6:5809666-5809688
Sequence CCCGAGCCATCGGTGCAGGTAGC ATGTGCTTGTGGATGTGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 2, 4: 81} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!