ID: 1003403458_1003403462

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1003403458 1003403462
Species Human (GRCh38) Human (GRCh38)
Location 6:5809630-5809652 6:5809678-5809700
Sequence CCATCGGTGCAGGTAGCTCCATG ATGTGTGCAGGTGCATGCGATGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 20, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!