ID: 1003411005_1003411014

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1003411005 1003411014
Species Human (GRCh38) Human (GRCh38)
Location 6:5863000-5863022 6:5863034-5863056
Sequence CCTGGTTGGCTGCCTCTCTAAGC CTCTGTGAGGAGCAGAGGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 49, 4: 502}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!