ID: 1003442349_1003442352

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1003442349 1003442352
Species Human (GRCh38) Human (GRCh38)
Location 6:6154933-6154955 6:6154947-6154969
Sequence CCATCTGTCTTCTCCATGGTATG CATGGTATGCTATATAAGGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 245} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!