ID: 1003482456_1003482463

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1003482456 1003482463
Species Human (GRCh38) Human (GRCh38)
Location 6:6546201-6546223 6:6546250-6546272
Sequence CCTTCGGATGAACAGCCGGGTGA CGCCTGTCCGCGGCCTAGATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 20}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!