ID: 1003483272_1003483278

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1003483272 1003483278
Species Human (GRCh38) Human (GRCh38)
Location 6:6552727-6552749 6:6552773-6552795
Sequence CCCACAACGAAATAGCCATTATG CAGAGGAAACAGAATGAAAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 102, 4: 935}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!