ID: 1003520370_1003520377

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1003520370 1003520377
Species Human (GRCh38) Human (GRCh38)
Location 6:6853529-6853551 6:6853566-6853588
Sequence CCTGTCTTGGCTAGGCACGGTGC CCCAGCACTTTGGGAGGTCGAGG
Strand - +
Off-target summary No data {0: 3354, 1: 125457, 2: 268887, 3: 211532, 4: 126539}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!