ID: 1003552259_1003552286

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1003552259 1003552286
Species Human (GRCh38) Human (GRCh38)
Location 6:7109254-7109276 6:7109306-7109328
Sequence CCCCCCGCCCCCAACTTCCCGCA CTCCCCGCTCGCGGTCTCTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 61, 4: 578} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!