ID: 1003556025_1003556047

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1003556025 1003556047
Species Human (GRCh38) Human (GRCh38)
Location 6:7141113-7141135 6:7141155-7141177
Sequence CCACGGCCGCAGGGGCCCCCTCG GCGGTGGGTGTCCGGTGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 274} {0: 1, 1: 0, 2: 1, 3: 10, 4: 111}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!