ID: 1003556033_1003556046

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1003556033 1003556046
Species Human (GRCh38) Human (GRCh38)
Location 6:7141130-7141152 6:7141154-7141176
Sequence CCCTCGGGCCGCCCCCAGGGCTC CGCGGTGGGTGTCCGGTGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 269} {0: 1, 1: 0, 2: 1, 3: 7, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!