ID: 1003583700_1003583706

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1003583700 1003583706
Species Human (GRCh38) Human (GRCh38)
Location 6:7366507-7366529 6:7366557-7366579
Sequence CCAGGGGTCTGGAATTTTGGTAC CAGCTCCTGATAAAAACCTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 23, 4: 141} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!