ID: 1003631974_1003631979

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1003631974 1003631979
Species Human (GRCh38) Human (GRCh38)
Location 6:7795443-7795465 6:7795459-7795481
Sequence CCCTGTTAGTTCAGGGATCCCCA ATCCCCAAGGCAGAGGGATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108} {0: 1, 1: 0, 2: 4, 3: 40, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!