ID: 1003640839_1003640843

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1003640839 1003640843
Species Human (GRCh38) Human (GRCh38)
Location 6:7873913-7873935 6:7873946-7873968
Sequence CCTAGCACGAGACGGTATTTTGG CTTCACAAGCAGAATGAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 24} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!