ID: 1003689718_1003689728

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1003689718 1003689728
Species Human (GRCh38) Human (GRCh38)
Location 6:8341327-8341349 6:8341355-8341377
Sequence CCTTCCACCCATCCCAAGAGCCA GGGTAGTGGTAACTTACTCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 44, 4: 452} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!