ID: 1003772349_1003772354

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1003772349 1003772354
Species Human (GRCh38) Human (GRCh38)
Location 6:9319444-9319466 6:9319463-9319485
Sequence CCTCCTTCCTAAGATGACATTTG TTTGAGGGTCAAGTAAATAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!