|
Left Crispr |
Right Crispr |
Crispr ID |
1003791217 |
1003791221 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
6:9549963-9549985
|
6:9550001-9550023
|
Sequence |
CCTACCATCTTCTGAAGATAACT |
GACAGCTCTTGGCCTATTACTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 17, 1: 183, 2: 194, 3: 123, 4: 177} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|