ID: 1003816843_1003816851

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1003816843 1003816851
Species Human (GRCh38) Human (GRCh38)
Location 6:9851252-9851274 6:9851280-9851302
Sequence CCCATGCCTGCCAGGCCCTCACC GCCTGTCTGGTCATTCCCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 428} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!