|
Left Crispr |
Right Crispr |
| Crispr ID |
1003819085 |
1003819092 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:9876007-9876029
|
6:9876028-9876050
|
| Sequence |
CCCTAACCTCCAATGCAGTCGTA |
TATGTGGAGATGAGGCCTTTGGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 2, 1: 29, 2: 217, 3: 769, 4: 2095} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|