|
Left Crispr |
Right Crispr |
| Crispr ID |
1003820674 |
1003820683 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:9893365-9893387
|
6:9893396-9893418
|
| Sequence |
CCTGTGATCCCAGCACTTTGGGA |
CGGGTGGGTTACCTGAAGTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2928, 1: 292542, 2: 261985, 3: 151313, 4: 136324} |
{0: 1, 1: 49, 2: 1708, 3: 20920, 4: 68132} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|