ID: 1003832820_1003832830

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1003832820 1003832830
Species Human (GRCh38) Human (GRCh38)
Location 6:10033330-10033352 6:10033369-10033391
Sequence CCAAGCTATGCAAAAGCGGCAGA GGAGCTGTTGCAAGAGTTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!