ID: 1003860659_1003860677

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1003860659 1003860677
Species Human (GRCh38) Human (GRCh38)
Location 6:10319358-10319380 6:10319411-10319433
Sequence CCATGGGGATAGAGGGATGTGGG GGGTTTTCCGTGGGGATGGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 3, 2: 4, 3: 31, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!