ID: 1003868333_1003868349

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1003868333 1003868349
Species Human (GRCh38) Human (GRCh38)
Location 6:10382824-10382846 6:10382872-10382894
Sequence CCATGCGTAGGACACTATAGGGG AGCAAGAAAGGGGGCGCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 33} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!