ID: 1003894728_1003894733

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1003894728 1003894733
Species Human (GRCh38) Human (GRCh38)
Location 6:10596538-10596560 6:10596553-10596575
Sequence CCATTCTCTTGGCCTCCGTTTTT CCGTTTTTCTGGAGGAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 84, 4: 687} {0: 1, 1: 0, 2: 3, 3: 17, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!