ID: 1003935705_1003935712

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1003935705 1003935712
Species Human (GRCh38) Human (GRCh38)
Location 6:10973191-10973213 6:10973230-10973252
Sequence CCCTCAGTTGATATCAGCTCCTA GAGCATCTAATTGGGCTGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 125} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!