ID: 1003936143_1003936150

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1003936143 1003936150
Species Human (GRCh38) Human (GRCh38)
Location 6:10976987-10977009 6:10977024-10977046
Sequence CCAGTTTTTTTGCAGGGTTCAGG CTTTCAGGGGGATTTGCTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 43, 4: 1300}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!