ID: 1003937611_1003937615

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1003937611 1003937615
Species Human (GRCh38) Human (GRCh38)
Location 6:10991858-10991880 6:10991903-10991925
Sequence CCTTCCACAGTCACCATTTCACT AAAAAATTGAAAGTCTGCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 303} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!