ID: 1003948447_1003948456

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1003948447 1003948456
Species Human (GRCh38) Human (GRCh38)
Location 6:11096136-11096158 6:11096178-11096200
Sequence CCCCAACCTTTTTGGTACCAGGG ATTTTTCCACAGACGGAGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 12, 3: 82, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!