ID: 1003992807_1003992812

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1003992807 1003992812
Species Human (GRCh38) Human (GRCh38)
Location 6:11503615-11503637 6:11503652-11503674
Sequence CCTTGCACTGGGTAAACCACGTT CTCATTTACCAGGTAAGTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 97} {0: 1, 1: 0, 2: 1, 3: 10, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!