ID: 1004122651_1004122661

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1004122651 1004122661
Species Human (GRCh38) Human (GRCh38)
Location 6:12839560-12839582 6:12839581-12839603
Sequence CCTGGTCCCACTGACCCCTCATA TAGGGGTACCAGGATTATCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!